si:dkey-69h6.1

Ensembl ID:
ENSDARG00000058232
ZFIN ID:
ZDB-GENE-070705-487
Description:
Novel protein similar to autism susceptibility candidate 2 (Auts2) [Source:UniProtKB/TrEMBL;Acc:A5WW
Human Orthologue:
FBRSL1
Human Description:
fibrosin-like 1 [Source:HGNC Symbol;Acc:29308]
Mouse Orthologue:
Fbrsl1
Mouse Description:
fibrosin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1920907]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40381 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1316 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081064 Essential Splice Site 261 937 3 15
ENSDART00000147657 Essential Splice Site 170 867 2 11
Genomic Location (Zv9):
Chromosome 5 (position 19510142)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17227634
GRCz11 5 17731630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTCTGCCCCCGGCAGCCATCATTGGGCCGCCCACTGCACCTCCCATG[G/A]TGCGTACCCCAGCCAGAAATGTGAGGATAAGTAAAAACAGATAGATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081064 Essential Splice Site 365 937 8 15
ENSDART00000147657 Essential Splice Site 279 867 7 11
Genomic Location (Zv9):
Chromosome 5 (position 19522372)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17239864
GRCz11 5 17743860
KASP Assay ID:
554-1230.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGTTCAAATCGCCTGGCAGATCTACCATCATCAGCAGAAGATGAAAG[T/C]AAGTTCTCTCAGAAGCCAAGAAAAGATTCTTTCTGAAATATAGTGTAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link