
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mpp4a
- Ensembl ID:
- ENSDARG00000058222
- ZFIN ID:
- ZDB-GENE-070912-523
- Human Orthologue:
- MPP4
- Human Description:
- membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) [Source:HGNC Symbol;Acc:13680]
- Mouse Orthologue:
- Mpp4
- Mouse Description:
- membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) Gene [Source:MGI Symbol;Acc:MGI:238
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa27359 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34581 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa27359
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081049 | Nonsense | 291 | 587 | 9 | 17 |
ENSDART00000141194 | None | 260 | None | 6 | |
ENSDART00000145775 | Nonsense | 281 | 307 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13977825)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 13730390 GRCz11 9 13701593 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTTAACTGAAGTTTTAATTCTTTTTTTGCAGCAAACAAAGGGAGCTGT[G/A]GTGGTCTCAACCTTATCAAGCTCACACCTGCATCAGACCCTGTACGTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34581
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081049 | Essential Splice Site | 386 | 587 | 13 | 17 |
ENSDART00000141194 | Essential Splice Site | 59 | 260 | 2 | 6 |
ENSDART00000145775 | None | 307 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13984446)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 13737011 GRCz11 9 13708214 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTGGCTCACTGTCTGATTAAAGCCTTAATGCTTTTCCATTTTTTCCAC[A/G]GGTCCATCAGGAGTGGGTGTAAATGAACTAAGAAGGAGGCTAATCAAAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: