slc25a26

Ensembl ID:
ENSDARG00000058208
ZFIN ID:
ZDB-GENE-050913-126
Description:
S-adenosylmethionine mitochondrial carrier protein [Source:UniProtKB/Swiss-Prot;Acc:Q4V9P0]
Human Orthologue:
SLC25A26
Human Description:
solute carrier family 25, member 26 [Source:HGNC Symbol;Acc:20661]
Mouse Orthologue:
Slc25a26
Mouse Description:
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31823 Essential Splice Site Available for shipment Available now
sa41802 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081035 Essential Splice Site 100 267 3 10
ENSDART00000147190 Essential Splice Site 100 170 3 7
Genomic Location (Zv9):
Chromosome 11 (position 16605897)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 16086597
GRCz11 11 16221232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACCTGGCCCCCATCACTCACATGCTGGCTGCTTCACTAGGAGAAATC[G/A]TAGGTTTCCTGATGTTATTCTTCTTTATTCAGTCCTGTTGTTTTGTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081035 Essential Splice Site 151 267 5 10
ENSDART00000147190 Essential Splice Site 151 170 5 7
Genomic Location (Zv9):
Chromosome 11 (position 16622882)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 16103582
GRCz11 11 16238217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTCAGAGGGCTGTACAGAGGTTATGGCAGTACAGTACTAAGAGAGG[T/C]AAGCTGATTTACTGTATGCACTTTAAGTATTCTTACTGCATCATTTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link