smc1al

Ensembl ID:
ENSDARG00000058203
ZFIN ID:
ZDB-GENE-040426-57
Description:
structural maintenance of chromosomes 1A, like [Source:RefSeq peptide;Acc:NP_997975]
Human Orthologue:
SMC1A
Human Description:
structural maintenance of chromosomes 1A [Source:HGNC Symbol;Acc:11111]
Mouse Orthologue:
Smc1a
Mouse Description:
structural maintenance of chromosomes 1A Gene [Source:MGI Symbol;Acc:MGI:1344345]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11612 Nonsense Available for shipment Available now
sa32430 Nonsense Available for shipment Available now
sa18059 Nonsense Available for shipment Available now
sa37639 Nonsense Available for shipment Available now
sa24270 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081016 Nonsense 200 1233 4 26
ENSDART00000121697 Nonsense 200 285 4 5

The following transcripts of ENSDARG00000058203 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12974472)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13106405
GRCz11 23 12862482
KASP Assay ID:
2261-7426.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAACTACCATCGCAAGAAAAACATAGCTGCTGAACGAAAAGAAGCC[A/T]AACAGGAAAAAGAGGAGGTGGGCTCCTAGTATTGTAATATGTTATCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081016 Nonsense 272 1233 5 26
ENSDART00000121697 Nonsense 272 285 5 5

The following transcripts of ENSDARG00000058203 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12974823)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13106756
GRCz11 23 12862833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGACCGTGTGGAGGAAGAGTTAAAAGACAAAAAGAAGGAGCTTGGC[A/T]GAATGATGAGAGACCAACAGATGATTGAGAAAGAGATCAAGTGAGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081016 Nonsense 465 1233 9 26
ENSDART00000121697   None 285 None 5

The following transcripts of ENSDARG00000058203 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12981150)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13113083
GRCz11 23 12869160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGGATGAACAGAAAAGAATGGAAGAGGAACTCACAGAAGAAGTAGAA[C/T]AGGCCAAACGAAGAATAGATGAGATCAACATGGAAYTTAACCAGGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081016 Nonsense 675 1233 13 26
ENSDART00000121697   None 285 None 5

The following transcripts of ENSDARG00000058203 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12990424)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13122357
GRCz11 23 12878434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAAAGGCCAAAGCTCGACGTTGGGATGAAAAAGCTGTTGATAAGCTG[A/T]AAGACAGAAAGGAAAAACTCACAGATGAACTTAAAGTAAGTTGTTGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081016 Essential Splice Site 954 1233 19 26
ENSDART00000121697   None 285 None 5

The following transcripts of ENSDARG00000058203 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12992720)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13124653
GRCz11 23 12880730
KASP Assay ID:
2261-7428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACTTCCTCTCCGATCGGGAACTATGGATGACATCAGCCAGGAAGAGG[T/A]GTGTGTATATGTGCTAGTCTTGCAGCTTAATTTTACCTTTGCTGTTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link