si:dkey-45k15.2

Ensembl ID:
ENSDARG00000058180
ZFIN ID:
ZDB-GENE-081028-71
Description:
hypothetical protein LOC563246 [Source:RefSeq peptide;Acc:NP_001138266]
Human Orthologue:
C14orf73
Human Description:
chromosome 14 open reading frame 73 [Source:HGNC Symbol;Acc:20120]
Mouse Orthologue:
1200009I06Rik
Mouse Description:
RIKEN cDNA 1200009I06 gene Gene [Source:MGI Symbol;Acc:MGI:1921363]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13690 Nonsense Available for shipment Available now
sa22213 Essential Splice Site Available for shipment Available now
sa22212 Nonsense Available for shipment Available now
sa35415 Nonsense Available for shipment Available now
sa15022 Nonsense Available for shipment Available now
sa38919 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080987 Nonsense 171 787 3 13
ENSDART00000148240 Nonsense 171 787 4 14
Genomic Location (Zv9):
Chromosome 13 (position 6841600)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7059623
GRCz11 13 7391825
KASP Assay ID:
2260-6010.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGAGCCAAAAYCMGAGGTTGCTGATGAATGTGAAGGCCAGATGGTGT[T/A]GGAGCTCAGAGACACATATGTTCTGCCGGAGATCCCAGCAATGCCTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080987 Essential Splice Site 189 787 3 13
ENSDART00000148240 Essential Splice Site 189 787 4 14
Genomic Location (Zv9):
Chromosome 13 (position 6841545)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7059678
GRCz11 13 7391880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGAGACACATATGTTCTGCCGGAGATCCCAGCAATGCCTTTGTCAGG[T/C]ATGATTGTCTGACAAGTATAAAGTGTGTCTCATCTTGGGTTACTTAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080987 Nonsense 453 787 6 13
ENSDART00000148240 Nonsense 453 787 7 14
Genomic Location (Zv9):
Chromosome 13 (position 6834151)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7067072
GRCz11 13 7399274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGAACATCACTTGACAGGGTTATTGAGTTGGAGAATGAGGAAATTTG[G/A]AAGGAAAGAAGAAAACCAGAGATTGATGAGGGAATTTACAGCTCACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080987 Nonsense 519 787 8 13
ENSDART00000148240 Nonsense 519 787 9 14
Genomic Location (Zv9):
Chromosome 13 (position 6831479)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7069744
GRCz11 13 7401946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCATTGACTGTGTTTGAAGGTTTGAATCAGCGTTTGTGGAGTCCTG[C/A]AGGGTTTTCTCGAACTCTTCTCTCTGGGCAGAGTATCACATCAGCTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080987 Nonsense 542 787 8 13
ENSDART00000148240 Nonsense 542 787 9 14
Genomic Location (Zv9):
Chromosome 13 (position 6831411)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7069812
GRCz11 13 7402014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTCTGGGCAGAGTATCACATMAGCTACATCAACAGCTTCAGYGATT[T/G]AAAGTAAGYCTTYGACAAGTATGTTTTAATCAAAAGTACCATTRYACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080987 Nonsense 764 787 13 13
ENSDART00000148240 Nonsense 764 787 14 14
Genomic Location (Zv9):
Chromosome 13 (position 6819498)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7081725
GRCz11 13 7413927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTTGGGGAGTTCTGGGAATAAAGAGCAAGCTCTCTTTAGTGAGATT[C/T]AAGCTTCAGCAAACACAGACTGTCTGGCAGGTACTCCCTTCTCCTGTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link