si:dkey-26l17.1

Ensembl ID:
ENSDARG00000058154
ZFIN IDs:
ZDB-GENE-091112-1, ZDB-GENE-091204-66
Human Orthologue:
ZNF385C
Human Description:
zinc finger protein 385C [Source:HGNC Symbol;Acc:33722]
Mouse Orthologue:
Zfp385c
Mouse Description:
zinc finger protein 385C Gene [Source:MGI Symbol;Acc:MGI:3608347]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13207 Nonsense Available for shipment Available now
sa33127 Nonsense Mutation detected in F1 DNA During 2018
sa26032 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055890 Nonsense 119 460 4 9
ENSDART00000132622 Nonsense 119 458 4 9
Genomic Location (Zv9):
Chromosome 3 (position 17490247)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17681123
GRCz11 3 17830863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGCTGAAGGCATTGGAGGCTCAGAAGAACAAACAGCAGAGACGACAA[C/T]WGGACAACYCCCACCACAACCGAGAGCGAGAGAAGGACAGAGAGAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055890 Nonsense 171 460 5 9
ENSDART00000132622 Nonsense 171 458 5 9
Genomic Location (Zv9):
Chromosome 3 (position 17474060)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17697310
GRCz11 3 17847050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCTCTGTCTCTCTTCAGCTGCTGTCAGCGACCCGGAGTCTGCGCTA[C/T]GAGTGGACGACGCTCACTGCAGTTCAGTGGTGCTGACGCCCATATCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055890 Missense 355 460 8 9
ENSDART00000132622 Essential Splice Site 355 458 None 9
Genomic Location (Zv9):
Chromosome 3 (position 17462319)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17709051
GRCz11 3 17858791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATTAAAAATGATTTTTATGCAGCTCAGTTCTCCCGATCTTTTGCAGC[A/C]GGGTGTCCGATGGAACGGTTATGCGGGCGGCGCAGTGTCTGCCATGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link