snap25b

Ensembl ID:
ENSDARG00000058117
ZFIN ID:
ZDB-GENE-980526-392
Description:
Synaptosomal-associated protein 25-B [Source:UniProtKB/Swiss-Prot;Acc:Q6PC54]
Human Orthologue:
SNAP25
Human Description:
synaptosomal-associated protein, 25kDa [Source:HGNC Symbol;Acc:11132]
Mouse Orthologue:
Snap25
Mouse Description:
synaptosomal-associated protein 25 Gene [Source:MGI Symbol;Acc:MGI:98331]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32130 Essential Splice Site Available for shipment Available now
sa7432 Missense Mutation detected in F1 DNA During 2018
sa36346 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080927 Essential Splice Site None 203 2 8
Genomic Location (Zv9):
Chromosome 17 (position 12200459)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12182981
GRCz11 17 12337047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGCCACACTCTAACCCAAAGCATTTTCCCTCTCTTTTATTTTCTCT[A/G]GCTTTCAAGTAAGAGCTACACTTTCCGTTTGAGTTGAGCAGCTCATCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080927 Missense 60 203 5 8
Genomic Location (Zv9):
Chromosome 17 (position 12180062)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12162584
GRCz11 17 12316650
KASP Assay ID:
554-4033.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCGGGGGCTGTAATTGACTAATGTTTAAATCAGAGCAACTGGAGCGC[A/T]TCGAAGAGGGAATGGATCAGATCAATAAGGACATGAAAGAAGCAGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080927 Essential Splice Site 94 203 5 8
Genomic Location (Zv9):
Chromosome 17 (position 12179957)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12162479
GRCz11 17 12316545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGATCTAGGAAATCTCTGTGGTCTATGTCCGTGTCCATGTAACAAG[T/C]AGGTGATGCCTGTCGCCTGCCTGCCTGCTTGCCTGAACCCGACAAATAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link