zgc:123256

Ensembl ID:
ENSDARG00000058114
ZFIN ID:
ZDB-GENE-051127-23
Description:
Inositol monophosphatase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDR3]
Human Orthologue:
IMPAD1
Human Description:
inositol monophosphatase domain containing 1 [Source:HGNC Symbol;Acc:26019]
Mouse Orthologue:
Impad1
Mouse Description:
inositol monophosphatase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31262 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080925 Essential Splice Site 167 341 2 5
Genomic Location (Zv9):
Chromosome 2 (position 11434284)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11859380
GRCz11 2 11642979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCACAGTCTGGATTGATCCACTGGACGCCACTCAGGAATACACAGG[T/C]TTGTGGCAAGTCTTTATTTCTGTTGTAAATCAGCTGCGAGAGAGGATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link