
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sardh
- Ensembl ID:
- ENSDARG00000058102
- ZFIN ID:
- ZDB-GENE-040426-996
- Description:
- sarcosine dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_957422]
- Human Orthologue:
- SARDH
- Human Description:
- sarcosine dehydrogenase [Source:HGNC Symbol;Acc:10536]
- Mouse Orthologue:
- Sardh
- Mouse Description:
- sarcosine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2183102]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21675 | Essential Splice Site | Available for shipment | Available now |
sa18270 | Splice Site, Nonsense | Available for shipment | Available now |
sa34856 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa34857 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21675
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080904 | Essential Splice Site | 269 | 924 | 5 | 22 |
ENSDART00000129253 | Essential Splice Site | 269 | 682 | 5 | 17 |
ENSDART00000131043 | Essential Splice Site | 269 | 924 | 4 | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 10364131)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 10439997 GRCz11 10 10398235 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAACTCCTCATGGCACCATCCGAACACCATGTGTGGTCAATTGTGCAGG[T/A]AAGGATGAGGCTGATTTCCCCAGCAGAGGGCAGTGTTTGATCATGAACGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18270
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080904 | Nonsense | 519 | 924 | 13 | 22 |
ENSDART00000129253 | Splice Site | None | 682 | None | 17 |
ENSDART00000131043 | Nonsense | 519 | 924 | 12 | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 10457363)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 10533229 GRCz11 10 10491467 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTCTGTTAAACTTGTGTTTTCTTTGTACTTTTCCTCAGGTTCTAGATTA[T/G]GATTACTATGGTGCATATAATGTTCCCAAGAACACGGTTTACAAATACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34856
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080904 | Essential Splice Site | 637 | 924 | 15 | 22 |
ENSDART00000129253 | Essential Splice Site | 551 | 682 | 13 | 17 |
ENSDART00000131043 | Essential Splice Site | 637 | 924 | 14 | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 10460566)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 10536432 GRCz11 10 10494670 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGTCTGGAGCCAAGCCCCTCCCACCTCCCACTGACACCCGAATTTAATG[G/A]TAACCAACACACATTATTCATCCCATTCAGGGTCACACTACTGATGCACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34857
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080904 | Nonsense | 895 | 924 | 21 | 22 |
ENSDART00000129253 | Nonsense | 653 | 682 | 16 | 17 |
ENSDART00000131043 | Nonsense | 895 | 924 | 20 | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 10526973)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 10602839 GRCz11 10 10561077 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTGTGCGCAGTGGAGATTTCACTCTGGAACGGATGGGCGTTACATAC[A/T]AGGCCACAGCCCACCTGAAGTCTCCCTTCGACCCTGAAAACAAGCGCGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: