WDR65

Ensembl ID:
ENSDARG00000058090
Description:
WD repeat domain 65 [Source:HGNC Symbol;Acc:26485]
Human Orthologue:
WDR65
Human Description:
WD repeat domain 65 [Source:HGNC Symbol;Acc:26485]
Mouse Orthologue:
Wdr65
Mouse Description:
WD repeat domain 65 Gene [Source:MGI Symbol;Acc:MGI:2686209]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38319 Nonsense Mutation detected in F1 DNA During 2018
sa8390 Nonsense Mutation detected in F1 DNA During 2018
sa16621 Essential Splice Site Available for shipment Available now
sa10548 Nonsense Available for shipment Available now
sa19696 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080900 Nonsense 119 1054 2 17
Genomic Location (Zv9):
Chromosome 2 (position 13258223)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13783448
GRCz11 2 13466234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGGTGGATGAGTTTGTCTGCATGGCCTTTTCTCCTGACTCAAAGTA[T/G]CTGATTGGTCAGGCAGGTGGGCCAGACTGGACTCTTTTTCTCTGGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080900 Nonsense 262 1054 4 17
Genomic Location (Zv9):
Chromosome 2 (position 13290835)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13816060
GRCz11 2 13498846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGATGAACCCTTCTCTGCGCTGCCACAGGTTACAGYCATCGTAAGTTA[T/A]TCTAATGGATTWGCTTGCTCCATGGGTCAAGGAACTGTGTGTTTGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080900 Essential Splice Site 721 1054 13 17
Genomic Location (Zv9):
Chromosome 2 (position 13397867)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13922849
GRCz11 2 13605635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTAKTTCAATAGAGAAATTATTTTGTAATAATTTTATTTTTTATTGC[A/C]GGTACTGAAAAAAGAGAAAGACAACCAACAAGAAGCCCACAATAAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080900 Nonsense 851 1054 15 17
Genomic Location (Zv9):
Chromosome 2 (position 13460042)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13985024
GRCz11 2 13668262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGGACACAGATGCTGAAATTCATGACATCCGCATGAAATATGAG[C/T]AAAATCTAAGAGAAGAAAAAAAGGCCCATTCAAAGCTCAAAGTGGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080900 Nonsense 977 1054 17 17
Genomic Location (Zv9):
Chromosome 2 (position 13461331)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13986313
GRCz11 2 13669551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAAAATGAAATCCAACAGCAAAAGGACCAGATGGTGGAGGTAGGATG[C/A]ATTTTAACTCCCTGGGATTGGCAAACGCATAAATGCGTTTTAGTACATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Telomere length: A genome-wide association study identifies a locus on chromosome 14q21 as a predictor of leukocyte telomere length and as a marker of susceptibility for bladder cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link