
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rprd2
- Ensembl ID:
- ENSDARG00000058089
- ZFIN ID:
- ZDB-GENE-030131-6641
- Description:
- regulation of nuclear pre-mRNA domain containing 2 [Source:RefSeq peptide;Acc:NP_956216]
- Human Orthologue:
- RPRD2
- Human Description:
- regulation of nuclear pre-mRNA domain containing 2 [Source:HGNC Symbol;Acc:29039]
- Mouse Orthologue:
- Rprd2
- Mouse Description:
- regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43223 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32233 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43223
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080897 | Nonsense | 581 | 1113 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 9518991)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 8977530 GRCz11 19 8896455 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTAAACAACCCAGCTGCAAAGACCCCTACAAATTCAAATTCTGAAAAG[C/T]AATCCCTGACCACGCCTGTTACAGAAGAATCTCATACACCTCCTAAAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32233
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080897 | Nonsense | 803 | 1113 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 9518325)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 8976864 GRCz11 19 8895789 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGTCTAGAAGCCACTGAAAGATCCAGTATGCTGCTTCAAGATATGAGA[C/T]AAAACCCTCTAATCCATAATGTGGCACCAAATCCTAAACTAGCGGAAGGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: