smyd3

Ensembl ID:
ENSDARG00000058050
ZFIN ID:
ZDB-GENE-051120-138
Description:
SET and MYND domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001032477]
Human Orthologue:
SMYD3
Human Description:
SET and MYND domain containing 3 [Source:HGNC Symbol;Acc:15513]
Mouse Orthologue:
Smyd3
Mouse Description:
SET and MYND domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1916976]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36344 Nonsense Mutation detected in F1 DNA During 2018
sa42879 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080847 Nonsense 212 380 7 11
ENSDART00000105236 Nonsense 213 429 7 12
ENSDART00000122178   None 151 None 7
Genomic Location (Zv9):
Chromosome 17 (position 11652810)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11635332
GRCz11 17 11789398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCTGCGCCAGCATGTCTCTGCTGAACCACGACTGCCAGCCCAACTG[T/A]ATCATGATGTTTGAGGGCAAGAGACTCACGCTGAGAGCTGTTCGGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080847 Nonsense 258 380 9 11
ENSDART00000105236 Nonsense 307 429 10 12
ENSDART00000122178   None 151 None 7
Genomic Location (Zv9):
Chromosome 17 (position 11629350)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11611872
GRCz11 17 11765938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTAGTCATGTCCTTAACTTTTTAATCAAAAGACTGGGATGAGCTGT[T/A]GAAGGAGAGCCAGGCCCTTCTGCACAGACATTCAGATGTCGTACCAGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link