zgc:56049

Ensembl ID:
ENSDARG00000058044
ZFIN ID:
ZDB-GENE-040426-873
Description:
ras-related protein Rab-1B [Source:RefSeq peptide;Acc:NP_957436]
Human Orthologue:
RAB1A
Human Description:
RAB1A, member RAS oncogene family [Source:HGNC Symbol;Acc:9758]
Mouse Orthologue:
Rab1
Mouse Description:
RAB1, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:97842]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34028 Nonsense Available for shipment Available now
sa20892 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055810 Nonsense 23 201 2 6
ENSDART00000125322 Nonsense 23 201 2 6
Genomic Location (Zv9):
Chromosome 7 (position 19353283)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17854511
GRCz11 7 18106780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGTTCAAGTTGCTCCTCATCGGTGACTCTGGAGTGGGAAAGTCGTG[T/A]CTGTTGTTGAGATTTGCTGTGAGTAAATGCACAGATGGGTTGTTTCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055810 Nonsense 96 201 5 6
ENSDART00000125322 Nonsense 96 201 5 6
Genomic Location (Zv9):
Chromosome 7 (position 19355407)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17856635
GRCz11 7 18108902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAATGAAGAGTTGTTTTGTCTTTTCTGCTCTCTCTATAGGAATCGTA[T/G]AACAATGTTAAACAGTGGCTTCAGGAAATAGACCGCTACGCAAGCGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link