six3a

Ensembl ID:
ENSDARG00000058008
ZFIN ID:
ZDB-GENE-990415-127
Description:
homeobox protein SIX3 [Source:RefSeq peptide;Acc:NP_571437]
Human Orthologue:
SIX3
Human Description:
SIX homeobox 3 [Source:HGNC Symbol;Acc:10889]
Mouse Orthologue:
Six3
Mouse Description:
sine oculis-related homeobox 3 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102764]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42147 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080808 Essential Splice Site 231 294 1 2
Genomic Location (Zv9):
Chromosome 13 (position 9825770)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10128099
GRCz11 13 10260574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTAAAAACAGGAGACAACGAGACAGGGCAGCGGCAGCAAAAAACAGG[T/A]CAGTCATGTTATGTATTGATACGGTTCTACAGAAATTGTGTGCTTCAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link