zgc:158671

Ensembl ID:
ENSDARG00000058003
ZFIN ID:
ZDB-GENE-070112-352
Description:
WAP four-disulfide core domain protein 1 [Source:RefSeq peptide;Acc:NP_001093470]
Human Orthologue:
WFDC1
Human Description:
WAP four-disulfide core domain 1 [Source:HGNC Symbol;Acc:15466]
Mouse Orthologue:
Wfdc1
Mouse Description:
WAP four-disulfide core domain 1 Gene [Source:MGI Symbol;Acc:MGI:1915116]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11402 Nonsense Available for shipment Available now
sa43068 Nonsense Mutation detected in F1 DNA During 2018
sa8512 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080788 Nonsense 81 220 2 7
Genomic Location (Zv9):
Chromosome 18 (position 14196615)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14642033
GRCz11 18 14610545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGCCACCGCAAATGCTGCCTGAGCGAGCCTGTGAGGTGCCTGGCTGT[C/T]GATCCGATTCTGAATGTGAGAGACACAAACGCTGCTGCTACAAYGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080788 Nonsense 121 220 3 7
Genomic Location (Zv9):
Chromosome 18 (position 14196907)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14642325
GRCz11 18 14610837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCTATGCTTAGTGCTGGACTGGTTGGTGCAACCCAAGCCGCGGTG[G/A]TTGGGAGGGAATGGCTGGCTTTTAGACGGGCCCGAGGAAGTTCTGCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080788 Nonsense 180 220 4 7
Genomic Location (Zv9):
Chromosome 18 (position 14199668)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14645086
GRCz11 18 14613598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAGGAAACCCCTCCGCTGGCATCCCRAACCGAGGACAGTGCATCAAA[C/T]AGAGGGGAAACTCAGGTCTGACTTCRTTCTTACTGTACATCCATTCACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link