svopl

Ensembl ID:
ENSDARG00000057983
ZFIN ID:
ZDB-GENE-041114-109
Description:
Putative transporter SVOPL [Source:UniProtKB/Swiss-Prot;Acc:Q1LVS8]
Human Orthologue:
SVOPL
Human Description:
SVOP-like [Source:HGNC Symbol;Acc:27034]
Mouse Orthologue:
Svopl
Mouse Description:
SV2 related protein homolog (rat)-like Gene [Source:MGI Symbol;Acc:MGI:2444335]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25275 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33395 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1011 Nonsense Available for shipment Available now
sa33394 Nonsense Mutation detected in F1 DNA During 2018
sa18140 Nonsense Available for shipment Available now
sa6048 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080744 Essential Splice Site 108 506 5 17
ENSDART00000129271 Essential Splice Site 85 483 4 16

The following transcripts of ENSDARG00000057983 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8840359)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9777207
GRCz11 4 9778123
KASP Assay ID:
554-7640.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCTGCGAATGGCATCTGGAGGATTGGCAAGTGGCCCTTGTCTCCACG[G/A]TGAGGAGCTCGTCCAATCAGAGCCCTGTATTTCGTGAAGTTTTGACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080744 Essential Splice Site 132 506 6 17
ENSDART00000129271 Essential Splice Site 109 483 5 16

The following transcripts of ENSDARG00000057983 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8839575)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9776423
GRCz11 4 9777339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGGGTCCTCTGTGGTTACATTGCTGACAAATACGGACGCTGGAAGG[T/A]GAGATGACATTTCTTTCGATTTTAGTATAACATGTTTTTATTAAGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080744 Nonsense 140 506 7 17
ENSDART00000129271 Nonsense 117 483 6 16

The following transcripts of ENSDARG00000057983 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8838581)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9775429
GRCz11 4 9776345
KASP Assay ID:
554-0915.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCAATTAAAATGTTTGTGYCCACAGGTGGTGTTTGGTGGTTTTGTAT[G/A]GGCGTCATATTTTTCTTTTCTCACTTCGTTCTCTACATCATACGGCTGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080744 Nonsense 302 506 11 17
ENSDART00000129271 Nonsense 279 483 10 16

The following transcripts of ENSDARG00000057983 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8835750)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9772598
GRCz11 4 9773514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCACCCTGATCAGCTCGGCCTTCAGGAGAACATCGCTCCTGCTGTG[G/A]TATTCATGGTAAAGTCTACCACACTTCTCCTCTTTTGTCTATTATGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080744 Nonsense 437 506 15 17
ENSDART00000129271 Nonsense 414 483 14 16

The following transcripts of ENSDARG00000057983 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8833359)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9770207
GRCz11 4 9771123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGYCACCAAATTTAAACTKTTTATCATTGGCGTGTGTGTNNNNNNNNNNNNTTGCAGGTTTA[T/A]CCTACATCTGTGCGYTCAATCGGAATGGGCTTTTGCACATCGTTCAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080744 Nonsense 500 506 16 17
ENSDART00000129271 Nonsense 477 483 15 16

The following transcripts of ENSDARG00000057983 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8831654)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9768502
GRCz11 4 9769418
KASP Assay ID:
554-3969.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCATTTGTGCCATAGGAGTTTTTTTCCTGCCCATTGAGACCAGAGGA[C/T]GAGCATTATTGGTAAACATCTACCTACTGTACTATRCAGTCAAGCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link