zgc:136890

Ensembl ID:
ENSDARG00000057949
ZFIN ID:
ZDB-GENE-060312-28
Description:
solute carrier family 43 member 3 [Source:RefSeq peptide;Acc:NP_001035011]
Human Orthologue:
SLC43A3
Human Description:
solute carrier family 43, member 3 [Source:HGNC Symbol;Acc:17466]
Mouse Orthologue:
Slc43a3
Mouse Description:
solute carrier family 43, member 3 Gene [Source:MGI Symbol;Acc:MGI:1931054]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22442 Essential Splice Site Available for shipment Available now
sa35657 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080712 Essential Splice Site 147 495 4 12
Genomic Location (Zv9):
Chromosome 14 (position 14974273)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16836259
GRCz11 14 17141912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTTCATTTCTGTGGGAGGAATTCTGTTCTTGATGACCAACATACAGG[T/C]ACTGAATCACCCTTTGGGATCCTAATAACAAACATATGAGCCGCTGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080712 Nonsense 450 495 11 12
Genomic Location (Zv9):
Chromosome 14 (position 14990129)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16852115
GRCz11 14 17157768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGTTTCGCTGCTCCAGTATCCCTGCTTTGCTCTCATTAAAGGGACAT[T/A]GGGTGGAGACCCTCTTTATGTAAGATTTCGAATGCTTTCAATGTTTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link