zgc:162182

Ensembl ID:
ENSDARG00000057933
ZFIN ID:
ZDB-GENE-070424-58
Description:
hypothetical protein LOC100038769 [Source:RefSeq peptide;Acc:NP_001083018]
Human Orthologue:
OGFR
Human Description:
opioid growth factor receptor [Source:HGNC Symbol;Acc:15768]
Mouse Orthologue:
Ogfr
Mouse Description:
opioid growth factor receptor Gene [Source:MGI Symbol;Acc:MGI:1919325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27770 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080692 Essential Splice Site 269 337 8 9
ENSDART00000128356 Missense 270 335 8 8
Genomic Location (Zv9):
Chromosome 11 (position 21699945)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20070148
GRCz11 11 20904702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCTGGGGCCCAAAGAAGATTCTGCAAAAGGAAACTTCTAAAGAAG[G/A]TGAGCAGGAAAGGGTAAGGACCCATAAGGCCATGCCTGGAATGAACAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link