si:dkey-22l11.5

Ensembl ID:
ENSDARG00000057929
ZFIN ID:
ZDB-GENE-030131-4546
Description:
Novel protein containing a NAF1 domain [Source:UniProtKB/TrEMBL;Acc:Q1LXY8]
Human Orthologue:
NAF1
Human Description:
nuclear assembly factor 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25126]
Mouse Orthologue:
Naf1
Mouse Description:
nuclear assembly factor 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2682306]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080689 Nonsense 58 503 2 9
ENSDART00000148105 Nonsense 54 499 2 9
Genomic Location (Zv9):
Chromosome 4 (position 9067131)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10003979
GRCz11 4 10004895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACACAGATGTGTTAATTGGACCTACAGATGAACCATGCACCAGTGAA[C/T]AGAGAGACGATCAGATCTCCAGCATTCAGCCTGAACAATCTAGCAAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link