
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
Q58EH4_DANRE
- Ensembl ID:
- ENSDARG00000057903
- Description:
- LOC553343 protein [Source:UniProtKB/TrEMBL;Acc:Q58EH4]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42895 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa15753 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42895
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080661 | Essential Splice Site | 389 | 543 | 12 | 16 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15328212)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15479040 GRCz11 17 15486973 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGACCACCGTCTCTAATTATCTGTCCAGTCTGTTTGTGAGGGATGAAG[G/A]TAATGCATATACATCCCTTCCAAACAATTTGTATGTTTTATGTTTTTACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15753
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080661 | Essential Splice Site | 450 | 543 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15327722)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15478550 GRCz11 17 15486483 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTTYGTATTAKAATTCTTCAGGAGAATTTCTGCCCCCTATGGAAAAAG[G/A]TTAGTAAAWGCACATCYTTGCATTTASACAAAARCTGTAAAATTATGTAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: