si:dkey-33c12.4

Ensembl ID:
ENSDARG00000057890
ZFIN ID:
ZDB-GENE-030131-2527
Description:
si:dkey-33c12.4 [Source:RefSeq peptide;Acc:NP_001155071]
Human Orthologue:
TTC31
Human Description:
tetratricopeptide repeat domain 31 [Source:HGNC Symbol;Acc:25759]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35424 Nonsense Mutation detected in F1 DNA During 2018
sa42140 Nonsense Mutation detected in F1 DNA During 2018
sa22229 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Nonsense 4 631 1 18
ENSDART00000144146   None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8732848)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9035468
GRCz11 13 9367491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATACAGTATTATATCAAATATAAATATATTCGTGATAATGTCAATAT[C/A]AAAAAAGCATACCATAGGACCAGGTGAGTGTTGTTAGGCTCTTTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Nonsense 263 631 8 18
ENSDART00000144146   None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8721438)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9024058
GRCz11 13 9356081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGAAACCTAAACCTGACAAGAAGCCTGCTCAAGCAAACCCAAAAAAA[C/T]AACACGAATCCCAGCAGAAAGCCACTGTGATGCCTCAAAAGCAGGTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Essential Splice Site 497 631 14 18
ENSDART00000144146   None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8710533)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9013153
GRCz11 13 9345176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTCGACCCAGCATGCCAACCGCTGCTCCACTTCCCCCTCATTCCCCG[T/C]AAGGCGCACACACATATCCCAGCAATCATGGTACATAACCATTTACCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link