zgc:114174

Ensembl ID:
ENSDARG00000057884
ZFIN ID:
ZDB-GENE-050626-103
Description:
hypothetical protein LOC574002 [Source:RefSeq peptide;Acc:NP_001020352]
Human Orthologues:
FBXO44, FBXO6
Human Descriptions:
F-box protein 44 [Source:HGNC Symbol;Acc:24847]
F-box protein 6 [Source:HGNC Symbol;Acc:13585]
Mouse Orthologues:
Fbxo44, Fbxo6
Mouse Descriptions:
F-box protein 44 Gene [Source:MGI Symbol;Acc:MGI:1354744]
F-box protein 6 Gene [Source:MGI Symbol;Acc:MGI:1354743]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31085 Nonsense Mutation detected in F1 DNA During 2018
sa13381 Nonsense Available for shipment Available now
sa13469 Nonsense Available for shipment Available now
sa8609 Nonsense Mutation detected in F1 DNA During 2018
sa39402 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060181 Nonsense 103 282 2 6
Genomic Location (Zv9):
Chromosome 23 (position 17052223)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16955162
GRCz11 23 16881505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCAGACCGCCAGAGGACTGGTGTCAGTTTTACTTTATAACTAAAAAA[C/T]GACGGAACCTGATCAAGAATCCCAAAGCTGAAGGTGAGCCATGTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060181 Nonsense 116 282 3 6
ENSDART00000060181 Nonsense 116 282 3 6
Genomic Location (Zv9):
Chromosome 23 (position 17052341)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16955280
GRCz11 23 16881623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACATWAATCANNTTTTTTTATTATTTGGTTRCTTTTTACTAGCTGGAT[T/A]GCAAGGATGGGGGATAAAAGTAGATAATAAAAAGGCCTGCTGGCTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060181 Nonsense 116 282 3 6
ENSDART00000060181 Nonsense 116 282 3 6
Genomic Location (Zv9):
Chromosome 23 (position 17052341)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16955280
GRCz11 23 16881623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACATWAATCANNTTTTTTTATTATTTGGTTRCTTTTTACTAGCTGGAT[T/A]GCAAGGATGGGGGATAAAAGTAGATAATAAAAAGGCCTGCTGGCTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060181 Nonsense 148 282 3 6
Genomic Location (Zv9):
Chromosome 23 (position 17052438)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16955377
GRCz11 23 16881720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAGRAAATAGAAAACCATTCCCGGACAACACAGTCACCAGATGTTA[T/A]GTAGCATCTRATGGGTATGTTTGATATATAGATCTTTYGAGAAAGTTCWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060181 Nonsense 197 282 5 6
Genomic Location (Zv9):
Chromosome 23 (position 17053942)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16956881
GRCz11 23 16883224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTTATCTGCAGGTATACCACAAACCTTGCTTATGGAAGTAGCTAT[C/T]AGGTCTGTATGGAACTGCTTAATGAGGAGATGCAACCCATTAGTAGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link