
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mrps31
- Ensembl ID:
- ENSDARG00000057855
- ZFIN ID:
- ZDB-GENE-030131-3715
- Description:
- 28S ribosomal protein S31, mitochondrial [Source:RefSeq peptide;Acc:NP_001121800]
- Human Orthologue:
- MRPS31
- Human Description:
- mitochondrial ribosomal protein S31 [Source:HGNC Symbol;Acc:16632]
- Mouse Orthologue:
- Mrps31
- Mouse Description:
- mitochondrial ribosomal protein S31 Gene [Source:MGI Symbol;Acc:MGI:1913153]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40418 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40418
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080609 | Nonsense | 76 | 428 | 2 | 7 |
ENSDART00000147007 | Nonsense | 76 | 428 | 2 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25822457)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23649722 GRCz11 5 24153522 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAATAAAGAGAGCTCCACATCCCTGTCAGATGACAAAGAAAAGAGACGA[G/T]AAGAGAATGAGGCTAAAGCTGAAGTTGGCACTGATGGCCAGAGGAACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: