si:dkey-27i16.3

Ensembl ID:
ENSDARG00000057773
ZFIN ID:
ZDB-GENE-091204-115
Human Orthologue:
PCDH20
Human Description:
protocadherin 20 [Source:HGNC Symbol;Acc:14257]
Mouse Orthologue:
Pcdh20
Mouse Description:
protocadherin 20 Gene [Source:MGI Symbol;Acc:MGI:2443376]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11477 Nonsense Available for shipment Available now
sa22452 Nonsense Available for shipment Available now
sa24956 Nonsense Mutation detected in F1 DNA During 2018
sa13628 Nonsense Available for shipment Available now
sa31977 Nonsense Available for shipment Available now
sa35668 Nonsense Available for shipment Available now
sa13218 Nonsense Available for shipment Available now
sa42371 Nonsense Mutation detected in F1 DNA During 2018
sa35669 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 77 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18470209)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14264662
GRCz11 14 14570225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACAGGGGATCTGTTCACTAAAGAWCGCCYTGATAGAGAAACTTTGTG[T/A]CCATCACATCAGGATGGAGAATGTACTTTTTTAAATACTGCAGTCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 117 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18470327)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14264780
GRCz11 14 14570343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAATGGTAATTGTTGTGAATGATATTAATGACAATGCTCCTGTTTTC[G/T]AAAGGAATGAAATTCCTCTACGCATACCTGAAGATACGTCCATTGGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 154 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18470440)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14264893
GRCz11 14 14570456
KASP Assay ID:
554-7496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACCAAGCCCAGGATAAGGACACTGCAAATAATGGCTTGATACATTA[T/A]CATTTAGAGGGATCTAATGGATTTTTTGGCATCAGACAAGAGGATTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 386 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18471136)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14265589
GRCz11 14 14571152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGAAACAGACAGCATGCCATTTTCTTTGAAACAGCAAGCAGGCAGCTA[T/A]TTGCTTTCAACATCAAAAGCTCTAGAWTTTGAGCTGTGCGGCGAGTACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 438 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18471290)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14265743
GRCz11 14 14571306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCAAAGTGGTGGTTCAAGATCTGAATGATAATGCCCCAAAGTTTGAA[C/T]AAACACGTTACGAAACAGACATCAAGGAGAACAACAAGCCTGGAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 452 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18471332)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14265785
GRCz11 14 14571348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGAACAAACACGTTACGAAACAGACATCAAGGAGAACAACAAGCCT[G/T]GAGAGTTTCTGCTGAAGGTACAGGCTACTGATGCAGATAGCCATCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 459 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18471353)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14265806
GRCz11 14 14571369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGACATCAAGGAGAACAACAAGCCTGGAGAGTTTCTGCTGAAGGTA[C/T]AGGCTACTGATGCAGATAGCCATCAGTTTGGCAAAGTAGAGTATAGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 674 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18471999)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14266452
GRCz11 14 14572015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCAGGCAGGAAGCATGATAACAAAGATCTACGCCATTGACGAGGACT[C/A]AGGAATGAATTCAGATATCACATATCAAATTATTGCAAGTGAACCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080527 Nonsense 734 833 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18472178)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14266631
GRCz11 14 14572194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCACCTTTTCATAGTTGTTCGTGATGGAGGAAAACCAGACCCGCTG[C/T]AGACCACCATATGGGTTAATTTACTGGTCAATGAAACTTTGGAAAAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Identification of IL6R and chromosome 11q13.5 as risk loci for asthma. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)
  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link