si:dkey-26c10.6

Ensembl ID:
ENSDARG00000057729
ZFIN ID:
ZDB-GENE-100922-51
Human Orthologues:
EPHA2, EPHA6, EPHB1, EPHB2, EPHB3, EPHB4
Human Descriptions:
EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
EPH receptor A6 [Source:HGNC Symbol;Acc:19296]
EPH receptor B1 [Source:HGNC Symbol;Acc:3392]
EPH receptor B2 [Source:HGNC Symbol;Acc:3393]
EPH receptor B3 [Source:HGNC Symbol;Acc:3394]
EPH receptor B4 [Source:HGNC Symbol;Acc:3395]
Mouse Orthologues:
Epha2, Epha6, Ephb1, Ephb2, Ephb3, Ephb4
Mouse Descriptions:
Eph receptor A2 Gene [Source:MGI Symbol;Acc:MGI:95278]
Eph receptor A6 Gene [Source:MGI Symbol;Acc:MGI:108034]
Eph receptor B1 Gene [Source:MGI Symbol;Acc:MGI:1096337]
Eph receptor B2 Gene [Source:MGI Symbol;Acc:MGI:99611]
Eph receptor B3 Gene [Source:MGI Symbol;Acc:MGI:104770]
Eph receptor B4 Gene [Source:MGI Symbol;Acc:MGI:104757]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32076 Nonsense Available for shipment Available now
sa44839 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36060 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45565 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080477 Nonsense 213 1003 5 19
ENSDART00000147483 Nonsense 79 869 2 16
Genomic Location (Zv9):
Chromosome 16 (position 14153407)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12512498
GRCz11 16 12403400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGAGCATGTGTGTCGCTCATGGGTGTTTCCATATTTTACCGTCGCTG[T/A]CCAGCCACCAGTCGTTTTCTGGCCTTTTACCCAGCCACGCCCTCTGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080477 Essential Splice Site 431 1003 8 19
ENSDART00000147483 Essential Splice Site 297 869 5 16
Genomic Location (Zv9):
Chromosome 16 (position 14114055)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12473146
GRCz11 16 12364048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGCATGGAAAAGCATGACTGCAATATGAGCTGTGTATGATTTCACA[G/A]GTTCAAGCAATGAACGAAGTGTCAGCGCTGAGCCCTTTTCCACCTCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080477 Essential Splice Site 592 1003 11 19
ENSDART00000147483 Essential Splice Site 458 869 8 16
Genomic Location (Zv9):
Chromosome 16 (position 14105437)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12464528
GRCz11 16 12355430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCTATTGGTTGTGATCGCCATCATCATTGTGTTTGTGTTCCGAAGG[T/C]ATGAACATTGAAACTCTCCACATCAGATATTAATCATATGCGAATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080477 Nonsense 604 1003 12 19
ENSDART00000147483 Nonsense 470 869 9 16
Genomic Location (Zv9):
Chromosome 16 (position 14104812)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12463903
GRCz11 16 12354805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTTTTCCACTAGTAAAAGGAGAGAAAGCCCTTACAGTGACCGACTG[C/T]AGCGATACATCAGCAACAGAGGTGAGAGCCTTCATGTGTGCTTATGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link