slc17a8

Ensembl ID:
ENSDARG00000057728
ZFIN ID:
ZDB-GENE-060503-416
Description:
Vesicular glutamate transporter 3 [Source:UniProtKB/Swiss-Prot;Acc:Q1L8X9]
Human Orthologue:
SLC17A8
Human Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 [Source:HGNC
Mouse Orthologue:
Slc17a8
Mouse Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 Gene [Source

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11329 Essential Splice Site Available for shipment Available now
sa36606 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080454 Essential Splice Site 119 590 3 12
Genomic Location (Zv9):
Chromosome 18 (position 15303335)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15655747
GRCz11 18 15624259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATTGAATTACAAGCTAACGTATTCTCTTCTAATGTTTGCATTGTTTA[G/A]CCAGCTCAGTTTAATTGGGATCCAGAGACAGTGGGATTAATACATGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080454 Nonsense 327 590 8 12
Genomic Location (Zv9):
Chromosome 18 (position 15310018)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15662430
GRCz11 18 15630942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTTCACTTCTATGCCCGTCTATGCCATCATTGTAGCAAACTTCTGC[C/T]GAAGCTGGACCTTTTACCTCCTGCTCATTAGTCAACCGGCTTACTTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Squamous cell carcinoma: Genome-wide association study identifies a novel susceptibility locus at 12q23.1 for lung squamous cell carcinoma in han chinese. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link