zgc:152778

Ensembl ID:
ENSDARG00000057726
ZFIN ID:
ZDB-GENE-061103-355
Description:
hypothetical protein LOC553349 [Source:RefSeq peptide;Acc:NP_001071004]
Human Orthologue:
ZNF185
Human Description:
zinc finger protein 185 (LIM domain) [Source:HGNC Symbol;Acc:12976]
Mouse Orthologue:
Zfp185
Mouse Description:
zinc finger protein 185 Gene [Source:MGI Symbol;Acc:MGI:108095]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30980 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42375 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7232 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106564 Essential Splice Site 76 1091 3 24
ENSDART00000126693 Essential Splice Site 76 609 4 13
ENSDART00000131084 Essential Splice Site 76 616 3 13
ENSDART00000143388 Essential Splice Site 76 1086 4 21
ENSDART00000106564 Essential Splice Site 76 1091 3 24
ENSDART00000126693 Essential Splice Site 76 609 4 13
ENSDART00000131084 Essential Splice Site 76 616 3 13
ENSDART00000143388 Essential Splice Site 76 1086 4 21
Genomic Location (Zv9):
Chromosome 14 (position 18539712)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14334165
GRCz11 14 14639728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCATCACCCACGACCAAATCGCCTCAGCCCAAAACTGACACAGAGAA[G/T]TATGATCTATACCCCTGTACAACATCCATATTTGTATTTATTCAATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106564 Essential Splice Site 76 1091 3 24
ENSDART00000126693 Essential Splice Site 76 609 4 13
ENSDART00000131084 Essential Splice Site 76 616 3 13
ENSDART00000143388 Essential Splice Site 76 1086 4 21
ENSDART00000106564 Essential Splice Site 76 1091 3 24
ENSDART00000126693 Essential Splice Site 76 609 4 13
ENSDART00000131084 Essential Splice Site 76 616 3 13
ENSDART00000143388 Essential Splice Site 76 1086 4 21
Genomic Location (Zv9):
Chromosome 14 (position 18539712)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14334165
GRCz11 14 14639728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCATCACCCACGACCAAATCGCCTCAGCCCAAAACTGACACAGAGAA[G/T]TATGATCTATACCCCTGTACAACATCCATATTTGTATTTATTCAATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106564 Nonsense 616 1091 12 24
ENSDART00000126693   None 609 None 13
ENSDART00000131084   None 616 None 13
ENSDART00000143388 Nonsense 652 1086 12 21
Genomic Location (Zv9):
Chromosome 14 (position 18535168)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14329621
GRCz11 14 14635184
KASP Assay ID:
554-4715.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGGCACAAGCTAAAACAGCAGCAGAGTCTAAACTAATGGAAGAAATT[A/T]AAGCTTCAATAAAAACAACAWCAGCAAGTGATGCTAAATCCACATCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link