
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nsdhl
- Ensembl ID:
- ENSDARG00000057723
- ZFIN ID:
- ZDB-GENE-050417-163
- Description:
- sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating [Source:RefSeq peptide;Acc:NP_001017674
- Human Orthologue:
- NSDHL
- Human Description:
- NAD(P) dependent steroid dehydrogenase-like [Source:HGNC Symbol;Acc:13398]
- Mouse Orthologue:
- Nsdhl
- Mouse Description:
- NAD(P) dependent steroid dehydrogenase-like Gene [Source:MGI Symbol;Acc:MGI:1099438]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35671 | Essential Splice Site | Available for shipment | Available now |
sa35670 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35671
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080458 | Essential Splice Site | None | 345 | None | 8 |
ENSDART00000139971 | None | 201 | 1 | 6 | |
ENSDART00000142405 | None | 185 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 14 (position 18559004)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 14353457 GRCz11 14 14659020 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTCGCCCAGTATCAATAAAGCTGTAACTCTTGTCCAAGTTTTTCAGG[T/C]GAGTGTTGCTTAAATTCTTTTTACAAAAATTAGAAAAAGTAATTTCTCGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35670
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080458 | Nonsense | 269 | 345 | 8 | 8 |
ENSDART00000139971 | None | 201 | None | 6 | |
ENSDART00000142405 | None | 185 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 14 (position 18547218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 14341671 GRCz11 14 14647234 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGATTCTGGTTGGCCTGGGCTACAGCGCTCCACGATACCACCTGCCCTA[T/A]GCGCTGGTCTATGGGATAGCTCTGCTGCTGTGGTTTATTTCCCTCATACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: