atl2

Ensembl ID:
ENSDARG00000057719
ZFIN ID:
ZDB-GENE-030131-6505
Description:
atlastin-2 [Source:RefSeq peptide;Acc:NP_001103492]
Human Orthologue:
ATL2
Human Description:
atlastin GTPase 2 [Source:HGNC Symbol;Acc:24047]
Mouse Orthologue:
Atl2
Mouse Description:
atlastin GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:1929492]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42136 Nonsense Mutation detected in F1 DNA During 2018
sa44782 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080460 Nonsense 187 606 3 13
ENSDART00000127841 Nonsense 205 624 3 13

The following transcripts of ENSDARG00000057719 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 7657612)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7962132
GRCz11 13 8294155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGGGAATCCAGGCTTGGAGCGAAGTATTTGTTGTGGAAAAGAAAGAT[G/T]GAACTAAGGTGGATGGGCATTCATTTAAAGTGTTATGTTGCCGTGAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080460 Essential Splice Site 380 606 9 13
ENSDART00000127841 Essential Splice Site 398 624 9 13

The following transcripts of ENSDARG00000057719 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 7651546)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7956066
GRCz11 13 8288089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCGGTGGAGCTAAAGTCACATGCAGAGATCTGGTGGAGTACTTCAAGG[T/A]CAGATTTCATTACTTTAGCCGCAGCAGCTGTAAACACAAACCAGATTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link