zgc:113346

Ensembl ID:
ENSDARG00000057716
ZFIN ID:
ZDB-GENE-050320-153
Description:
hypothetical protein LOC541448 [Source:RefSeq peptide;Acc:NP_001013591]
Human Orthologue:
ACRC
Human Description:
acidic repeat containing [Source:HGNC Symbol;Acc:15805]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38987 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080445 Nonsense 427 586 11 13
ENSDART00000129076 Nonsense 430 589 11 13
Genomic Location (Zv9):
Chromosome 14 (position 18570789)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14365242
GRCz11 14 14670805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGACTGCAGGATATTGCATCTCTGGTCAGGAGCGTGGCACTGGGAAA[C/T]GATATGCCCGTATTGAGCTGTCTGTCAAAGTGTGCGACTCTGCAGGTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link