zgc:92407

Ensembl ID:
ENSDARG00000057714
ZFIN ID:
ZDB-GENE-040704-33
Description:
Cytidine monophosphate-N-acetylneuraminic acid hydroxylase [Source:UniProtKB/Swiss-Prot;Acc:Q6GML1]
Human Orthologues:
AL133268.1, CMAH
Human Descriptions:
cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) p
Putative cytidine monophosphate-N-acetylneuraminic acid hydroxylase-like protein [Source:UniProtKB/S
Mouse Orthologue:
Cmah
Mouse Description:
cytidine monophospho-N-acetylneuraminic acid hydroxylase Gene [Source:MGI Symbol;Acc:MGI:103227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40200 Nonsense Mutation detected in F1 DNA During 2018
sa33356 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080439 Nonsense 79 591 2 14
Genomic Location (Zv9):
Chromosome 4 (position 2094932)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2384639
GRCz11 4 2233952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTGTGTGTTCGTTACAGAACAGTTCGGTGTACCAAACACTACTGG[A/T]AACTCAACGTGGCCACTATGCAGTACGTCAATCCACCAGACAGCTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080439 Nonsense 434 591 11 14
Genomic Location (Zv9):
Chromosome 4 (position 2106940)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2396647
GRCz11 4 2245960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCCATCACTGATCCGCCTCATGGCACAAAGATCTACAAGGACAACT[G/A]GGAGTTTGACCTGTATTTGAATCAATTGAACGCCTCCATTTCAGCTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link