zgc:175264

Ensembl ID:
ENSDARG00000057708
ZFIN ID:
ZDB-GENE-080204-123
Description:
putative homeodomain transcription factor 1 [Source:RefSeq peptide;Acc:NP_001107901]
Human Orthologue:
PHTF1
Human Description:
putative homeodomain transcription factor 1 [Source:HGNC Symbol;Acc:8939]
Mouse Orthologue:
Phtf1
Mouse Description:
putative homeodomain transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1332671]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21884 Nonsense Available for shipment Available now
sa933 Nonsense F2 line generated During 2018
sa676 Essential Splice Site Available for shipment Available now
sa21883 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080355   257 691 8 17
ENSDART00000124369 Nonsense 334 779 13 22
Genomic Location (Zv9):
Chromosome 11 (position 19234535)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18651849
GRCz11 11 18814191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCATCAGCGCCTCCCAAATATGCCAGCGCGCTGAGAAACAGACTTCA[C/T]AACGTTCCCAAGAACAATGTACAACCCCAGGCTCAGGTGGATATCTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa933
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080355 Nonsense 306 691 9 17
ENSDART00000124369 Nonsense 394 779 14 22
Genomic Location (Zv9):
Chromosome 11 (position 19234309)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18651623
GRCz11 11 18813965
KASP Assay ID:
554-0838.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCCTTCAGAGGGATCGCATCCTGCTTCTGATACAGATGATATGTTGTG[G/A]GAGGAGCTTTTACAAGATTCTGACTCCGCCTCCACAGGAAGTAGTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080355 Essential Splice Site 559 691 13 17
ENSDART00000124369 Essential Splice Site 647 779 18 22
Genomic Location (Zv9):
Chromosome 11 (position 19229688)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18647002
GRCz11 11 18809344
KASP Assay ID:
554-0584.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAATTTTCCTCTTGGCTTTGTCTATTGCCTTTATCATCTGTGCACAG[G/A]TTAGCTGTTTCTTCTACTAAACACTTTTTTTNCTGGCACACCCTTTAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080355 Essential Splice Site 643 691 15 17
ENSDART00000124369 Essential Splice Site 731 779 20 22
Genomic Location (Zv9):
Chromosome 11 (position 19223934)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18641248
GRCz11 11 18803590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGAACATAGTGAACAATGTGCTGAGGCTGGCCACCAAATTACTGAAA[G/A]TAAGACCAGTATAAAAACATCACTCTTTGGGGAAAAAAACAAAACACGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link