
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:175264
- Ensembl ID:
- ENSDARG00000057708
- ZFIN ID:
- ZDB-GENE-080204-123
- Description:
- putative homeodomain transcription factor 1 [Source:RefSeq peptide;Acc:NP_001107901]
- Human Orthologue:
- PHTF1
- Human Description:
- putative homeodomain transcription factor 1 [Source:HGNC Symbol;Acc:8939]
- Mouse Orthologue:
- Phtf1
- Mouse Description:
- putative homeodomain transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1332671]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21884 | Nonsense | Available for shipment | Available now |
sa933 | Nonsense | F2 line generated | During 2018 |
sa676 | Essential Splice Site | Available for shipment | Available now |
sa21883 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21884
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080355 | 257 | 691 | 8 | 17 | |
ENSDART00000124369 | Nonsense | 334 | 779 | 13 | 22 |
- Genomic Location (Zv9):
- Chromosome 11 (position 19234535)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18651849 GRCz11 11 18814191 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTCATCAGCGCCTCCCAAATATGCCAGCGCGCTGAGAAACAGACTTCA[C/T]AACGTTCCCAAGAACAATGTACAACCCCAGGCTCAGGTGGATATCTGACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa933
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080355 | Nonsense | 306 | 691 | 9 | 17 |
ENSDART00000124369 | Nonsense | 394 | 779 | 14 | 22 |
- Genomic Location (Zv9):
- Chromosome 11 (position 19234309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18651623 GRCz11 11 18813965 - KASP Assay ID:
- 554-0838.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGCCTTCAGAGGGATCGCATCCTGCTTCTGATACAGATGATATGTTGTG[G/A]GAGGAGCTTTTACAAGATTCTGACTCCGCCTCCACAGGAAGTAGTGAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa676
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080355 | Essential Splice Site | 559 | 691 | 13 | 17 |
ENSDART00000124369 | Essential Splice Site | 647 | 779 | 18 | 22 |
- Genomic Location (Zv9):
- Chromosome 11 (position 19229688)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18647002 GRCz11 11 18809344 - KASP Assay ID:
- 554-0584.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATCAATTTTCCTCTTGGCTTTGTCTATTGCCTTTATCATCTGTGCACAG[G/A]TTAGCTGTTTCTTCTACTAAACACTTTTTTTNCTGGCACACCCTTTAGACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21883
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080355 | Essential Splice Site | 643 | 691 | 15 | 17 |
ENSDART00000124369 | Essential Splice Site | 731 | 779 | 20 | 22 |
- Genomic Location (Zv9):
- Chromosome 11 (position 19223934)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 18641248 GRCz11 11 18803590 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTTGAACATAGTGAACAATGTGCTGAGGCTGGCCACCAAATTACTGAAA[G/A]TAAGACCAGTATAAAAACATCACTCTTTGGGGAAAAAAACAAAACACGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Type 1 diabetes: Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: