si:dkey-38o19.8

Ensembl ID:
ENSDARG00000057680
ZFIN ID:
ZDB-GENE-100922-240
Human Orthologues:
FOXJ2, FOXJ3
Human Descriptions:
forkhead box J2 [Source:HGNC Symbol;Acc:24818]
forkhead box J3 [Source:HGNC Symbol;Acc:29178]
Mouse Orthologues:
Foxj2, Foxj3
Mouse Descriptions:
forkhead box J2 Gene [Source:MGI Symbol;Acc:MGI:1926805]
forkhead box J3 Gene [Source:MGI Symbol;Acc:MGI:2443432]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39083 Nonsense Mutation detected in F1 DNA During 2018
sa32077 Essential Splice Site Available for shipment Available now
sa22778 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Nonsense 168 516 4 9
ENSDART00000139916 Nonsense 168 448 5 8
Genomic Location (Zv9):
Chromosome 16 (position 14528112)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12886571
GRCz11 16 12776691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATACTTTTGTTTCAGACTCCTTTCCCAGAGACACAACTGCCTGCCAAT[C/T]AACCGGAGCCCCTCCCCCCTCAGCCAGACACCAAGAGCACATTCCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Essential Splice Site 240 516 5 9
ENSDART00000139916 Essential Splice Site 240 448 6 8
Genomic Location (Zv9):
Chromosome 16 (position 14524807)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12883266
GRCz11 16 12773386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCAGTCGCTCTGTCGCTCCATGAGAGAGAAGGTCACTTCCCAATG[T/C]AAGTAAAACTGCTTTTTCATTTAAGCTCATTAATTAAGATTCACAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Essential Splice Site 483 516 None 9
ENSDART00000139916   449 448 None 8
Genomic Location (Zv9):
Chromosome 16 (position 14515514)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12873973
GRCz11 16 12764093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCAGGGGGACTGCAGCCCACCACCAGCCAGCCCATGACTCCCAACGG[T/G]ATGTCCAGAGATCACTTACATCCATATAGGAACAGTGCATATTTAGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link