sprn2

Ensembl ID:
ENSDARG00000057665
ZFIN ID:
ZDB-GENE-041221-1
Description:
shadow of prion protein 2 [Source:RefSeq peptide;Acc:NP_001007781]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21716 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080391 Nonsense 11 135 1 1
Genomic Location (Zv9):
Chromosome 10 (position 20718233)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20679647
GRCz11 10 20637028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAAGGAGTCTTCAGTCATGCTGGGCAATCAGAAGCTGCTGATCATAT[G/A]GGTGTGGATGTTGCTGTTGGCGTCGCTGTGCCCTTGTTTCCACTGTAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link