si:dkeyp-69b9.5

Ensembl ID:
ENSDARG00000057652
ZFIN ID:
ZDB-GENE-100922-6
Description:
D-box binding protein 2 [Source:RefSeq peptide;Acc:NP_001183991]
Human Orthologue:
DBP
Human Description:
D site of albumin promoter (albumin D-box) binding protein [Source:HGNC Symbol;Acc:2697]
Mouse Orthologue:
Dbp
Mouse Description:
D site albumin promoter binding protein Gene [Source:MGI Symbol;Acc:MGI:94866]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22782 Nonsense Available for shipment Available now
sa663 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa22782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080372 Nonsense 132 374 2 4
ENSDART00000139102 Nonsense 132 374 3 5
Genomic Location (Zv9):
Chromosome 16 (position 15362317)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13720776
GRCz11 16 13610896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGCTATGGGAACGAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTG[C/T]AGTACATGGATCTCGAGGAGTTCCTGACGGAGAACGGGATGAGCAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa663
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080372 Nonsense 348 374 4 4
ENSDART00000139102 Nonsense 348 374 5 5
Genomic Location (Zv9):
Chromosome 16 (position 15354684)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13713143
GRCz11 16 13603263
KASP Assay ID:
554-0571.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTCAGTGAGGGCCGCRTTCCTGGAGCGTGAAAACGCTGCTCTCAGA[C/T]AGGAGGTGGCCGATATGCGCAAAGAGCTCGGCCGCTGCCGTAACATCCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link