
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
adam8b
- Ensembl ID:
- ENSDARG00000057644
- ZFIN ID:
- ZDB-GENE-070808-1
- Mouse Orthologue:
- Adam8
- Mouse Description:
- a disintegrin and metallopeptidase domain 8 Gene [Source:MGI Symbol;Acc:MGI:107825]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10008 | Nonsense | Available for shipment | Available now |
sa41968 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa6236 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22036 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10008
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066471 | Nonsense | 241 | 819 | 9 | 23 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9879416)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 9087371 GRCz11 12 9125214 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTTWGATNNNNNGAAACAYACTAAAAACATMAKTCTTTTCTCAGTTGTA[T/A]CGATCTCTTAATATCCGAGWGATGTTGGTGGGTCTTGAGGTCTGGATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41968
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066471 | Essential Splice Site | 324 | 819 | 11 | 23 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9876994)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 9084949 GRCz11 12 9122792 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGATTGTTTTTTGTTTTTAAAGACAATTACACAATATGCTGTTATTTTC[A/C]GGATCATAATCAGAACCCACTGGGCCTGGCATCCACAATTGCACATGAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6236
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066471 | Nonsense | 638 | 819 | 17 | 23 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9859021)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 9066976 GRCz11 12 9104819 - KASP Assay ID:
- 554-5369.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATAAGTGCCAAGAMTTGAACATTTATGGTWGCATTGAAGRCTGTTCACTG[C/T]AGTGCAATGGTCGAGGGGTGAGATCAAAYCTYCTATTATTATATTTATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22036
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066471 | Essential Splice Site | 672 | 819 | 19 | 23 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9858748)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 9066703 GRCz11 12 9104546 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTAAATAACCTGTAATGTTTTGACACGTTTTACTCTTCTTTCCAACAA[G/A]CAAAGACCATTGGCATCTCAGTAGCTGTTGCAGTCGCTGTGCTTGTGGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: