
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-191d7.6
- Ensembl ID:
- ENSDARG00000057583
- ZFIN IDs:
- ZDB-GENE-040724-79, ZDB-GENE-040724-79, ZDB-GENE-081104-156
- Description:
- Novel protein similar to vertebrate HLA-B associated transcript 2 (BAT2) [Source:UniProtKB/TrEMBL;Ac
- Human Orthologue:
- BAT2L2
- Human Description:
- HLA-B associated transcript 2-like 2 [Source:HGNC Symbol;Acc:24903]
- Mouse Orthologue:
- Bat2l2
- Mouse Description:
- HLA-B associated transcript 2-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913754]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43402 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36996 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11325 | Essential Splice Site | Available for shipment | Available now |
sa23657 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43402
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080289 | Nonsense | 799 | 2814 | 13 | 32 |
ENSDART00000133936 | None | 377 | None | 8 | |
ENSDART00000135212 | Nonsense | 339 | 1630 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 15058561)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15153197 GRCz11 20 15052700 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCTCCTAAGCAACTGGTACGACGAGAGCCCACGGACAACAGCAGCTCT[G/T]GATCAGACACTTTTGATCATCTGACACGACCAATCAGAGAACATGGAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36996
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080289 | Nonsense | 1076 | 2814 | 14 | 32 |
ENSDART00000133936 | None | 377 | None | 8 | |
ENSDART00000135212 | Nonsense | 616 | 1630 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 15057645)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15152281 GRCz11 20 15051784 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGAAGAGAGAAAGAAGAGCAACATGAACGAGGAGATCGAACCAAAAAA[G/T]AAGGATTTGCACCCAAAGGTGCTTCGTCAGCTGCTATAGTGGCATGTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11325
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080289 | Essential Splice Site | 2006 | 2814 | 19 | 32 |
ENSDART00000133936 | None | 377 | None | 8 | |
ENSDART00000135212 | Essential Splice Site | 1546 | 1630 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 15053550)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15148186 GRCz11 20 15047689 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGCAGAGGCAAAAACAGCCCCGTGCTGGACCTGTCAAGCCTCAGAAGG[T/C]AGTGTTTCATGRAGAGGGAAGTGAATCATGAAGAGTAACAGATTTATAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23657
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080289 | Nonsense | 2555 | 2814 | 28 | 32 |
ENSDART00000133936 | None | 377 | None | 8 | |
ENSDART00000135212 | None | 1630 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 15038781)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 15133689 GRCz11 20 15029360 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCTCTTCCGCCGACTCCTCCTCAAGCGCCACCTCCCAGCCTCAACCGG[C/T]AGCCACCCAACAATCCGCCCTACCGTGGCCTCATTGGCCAAAACACACAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: