zgc:193699

Ensembl ID:
ENSDARG00000057550
ZFIN ID:
ZDB-GENE-060810-140
Description:
hypothetical protein LOC100170828 [Source:RefSeq peptide;Acc:NP_001124134]
Human Orthologues:
TRIM50, TRIM62, TRIM72, TRIM73, TRIM74
Human Descriptions:
tripartite motif-containing 50 [Source:HGNC Symbol;Acc:19017]
tripartite motif-containing 62 [Source:HGNC Symbol;Acc:25574]
tripartite motif-containing 72 [Source:HGNC Symbol;Acc:32671]
tripartite motif-containing 73 [Source:HGNC Symbol;Acc:18162]
tripartite motif-containing 74 [Source:HGNC Symbol;Acc:17453]
Mouse Orthologues:
Trim50, Trim62, Trim72
Mouse Descriptions:
tripartite motif-containing 50 Gene [Source:MGI Symbol;Acc:MGI:2664992]
tripartite motif-containing 62 Gene [Source:MGI Symbol;Acc:MGI:1914775]
tripartite motif-containing 72 Gene [Source:MGI Symbol;Acc:MGI:3612190]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13567 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080247 Essential Splice Site None 426 None 7
ENSDART00000131326 Essential Splice Site None 252 None 6

The following transcripts of ENSDARG00000057550 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 19890230)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15684683
GRCz11 14 15990246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTGAGCACCAGACCAAAGCAAACCAAACCAAAGAAAAAGTAGCGAGTG[T/A]GAGTTATTTYACGTATTTACATAATGTTTATTGTTTCATTCAGTAACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link