zgc:171485

Ensembl ID:
ENSDARG00000057531
ZFIN ID:
ZDB-GENE-080204-27
Description:
Post-GPI attachment to proteins factor 3 [Source:UniProtKB/Swiss-Prot;Acc:A8WFS8]
Human Orthologue:
PGAP3
Human Description:
post-GPI attachment to proteins 3 [Source:HGNC Symbol;Acc:23719]
Mouse Orthologue:
Pgap3
Mouse Description:
post-GPI attachment to proteins 3 Gene [Source:MGI Symbol;Acc:MGI:2444461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1118 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091519 Nonsense 67 316 3 9
Genomic Location (Zv9):
Chromosome 12 (position 10218104)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9426059
GRCz11 12 9463902
KASP Assay ID:
554-1019.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAGTGTGYGATSTTTCAGGCTGGACGTGTCGTGATGACTGCAGATAT[C/T]AGTGCATGTGGACCACCGTGGGYCTTTACCAGGCTGAAGGCTACAGCATA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link