
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-32j10
- Ensembl ID:
- ENSDARG00000057508
- ZFIN ID:
- ZDB-GENE-100922-283
- Human Orthologue:
- NBEAL2
- Human Description:
- neurobeachin-like 2 [Source:HGNC Symbol;Acc:31928]
- Mouse Orthologue:
- Nbeal2
- Mouse Description:
- neurobeachin-like 2 Gene [Source:MGI Symbol;Acc:MGI:2448554]
Alleles
There are 10 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31003 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa42692 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18226 | Nonsense | Available for shipment | Available now |
sa15725 | Nonsense | Available for shipment | Available now |
sa13722 | Nonsense | Available for shipment | Available now |
sa15336 | Nonsense | Available for shipment | Available now |
sa36080 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22794 | Nonsense | Available for shipment | Available now |
sa44844 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22793 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31003
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 42 | 2801 | 2 | 55 |
ENSDART00000135050 | None | 2647 | None | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18529960)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16572900 GRCz11 16 16480877 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGTTGGAGGCATTCGTGGCGTCTTTTGAGAAGGTCATTGATGTGCACT[C/A]GATTGAGCCTCGCCGGTGAGTCAGTTTCATGCTGACCTATCAAAATGTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42692
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 222 | 2801 | 7 | 55 |
ENSDART00000135050 | Nonsense | 162 | 2647 | 5 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18520139)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16563079 GRCz11 16 16471056 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTGGTGGTGAGGCTGGTGCATCTACAGGGAGCTGTAATCAGTGGATGC[A/T]AGGTAAATTAGACCCTTAGGCCCTGTTTACACTGACATGTGTGAACGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18226
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 254 | 2801 | 8 | 55 |
ENSDART00000135050 | Nonsense | 194 | 2647 | 6 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18519916)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16562856 GRCz11 16 16470833 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCATGTCTGTGTTGCGCTCCTGGTGCCTYTGTCCTGCCTCATCCCCACAG[C/T]AGCCCAGGRACCCTCAGCTGCTCAGGATGGCCCYTCGCTGTCTGACTGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15725
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 1075 | 2801 | 21 | 55 |
ENSDART00000135050 | Nonsense | 984 | 2647 | 18 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18476529)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16519343 GRCz11 16 16427320 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACCTGCTCTTTGACTTCCGCATCTGGAGCCGCAGCCACTTCGCTGTCTG[T/A]CTGGGTAATAAAAAATACTTTGACAAMCAKAAAACATCATTRTAGCGTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13722
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 1291 | 2801 | 26 | 55 |
ENSDART00000135050 | Nonsense | 1200 | 2647 | 23 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18467126)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16509940 GRCz11 16 16417917 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGACTTRTTGGCAGTGGTGTACTTATCCCATCGTGCCGATCTCAGTGCT[C/T]GACTAGAAATTGTTCGTAAGGTAAGTGATGGATTATCAAAGGATTTGTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15336
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 1308 | 2801 | 27 | 55 |
ENSDART00000135050 | Nonsense | 1217 | 2647 | 24 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18466492)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16509306 GRCz11 16 16417283 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTKTTTTNTCCCTGCAGCTCTTCTGCTTGATCCACTCCAACGAAGAGTA[T/G]GTGAARCAGCTGGCTCATCAATCAGGCTGGCAGGATGTTCTCACCAAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36080
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Essential Splice Site | 1689 | 2801 | 31 | 55 |
ENSDART00000135050 | Essential Splice Site | 1535 | 2647 | 27 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18451897)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16494711 GRCz11 16 16402688 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAAAACCATGAGAATAAATTTCAACAACTGCTTTTTTTTTTTTTCTCTC[A/T]GGTGTGTGAGATGGCATGTCTAAAGCTTCACAGTTTGCTGCAGACAGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22794
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 1802 | 2801 | 32 | 55 |
ENSDART00000135050 | Nonsense | 1648 | 2647 | 28 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18447331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16490145 GRCz11 16 16398122 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATGTTTTTCCTAATGTATGCCTGCAGGTGGAGCCCACAATGCAGCAGTA[T/A]GAGCTGGACACTTTTGGGAAGAGCCACGACTTGATGTCCAACTTCTGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44844
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 2202 | 2801 | 41 | 55 |
ENSDART00000135050 | Nonsense | 2048 | 2647 | 37 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18433163)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16475977 GRCz11 16 16383954 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGTATGAGAGTTTTGAAGACCCAACAGGCACTATTGATAAGTTCCACTA[T/G]GGCACACACTACTCTAATGCTGCTGGCGTCATGCACTACATGATCCGCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22793
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031188 | Nonsense | 2349 | 2801 | 44 | 55 |
ENSDART00000135050 | Nonsense | 2195 | 2647 | 40 | 51 |
The following transcripts of ENSDARG00000057508 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 18428643)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16471457 GRCz11 16 16379434 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCAACGGGGACCTGAAGCAGTGGAGGCTCTTAATGTCTTCTACTACTG[C/A]ACTTATGAGGGTAAGAGACCTCTTATGAGTTCACATTAGCTGTTTCCTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: