
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
immt
- Ensembl ID:
- ENSDARG00000057454
- ZFIN ID:
- ZDB-GENE-030131-5417
- Description:
- mitochondrial inner membrane protein [Source:RefSeq peptide;Acc:NP_001001401]
- Human Orthologue:
- IMMT
- Human Description:
- inner membrane protein, mitochondrial [Source:HGNC Symbol;Acc:6047]
- Mouse Orthologue:
- Immt
- Mouse Description:
- inner membrane protein, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1923864]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22456 | Essential Splice Site | Available for shipment | Available now |
sa42380 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38989 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa35678 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22456
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080120 | Essential Splice Site | 188 | 757 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20032529)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 15797264 GRCz11 14 16102827 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCCGCACCAGGTACAAGTGATGAAAGCCCATCTGGCCACTCGGCGGCAG[G/A]TCAGCATTGGATCATTCACAGTCTTCTGCTTATGACAACTGATCCACAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42380
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080120 | Essential Splice Site | 273 | 757 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20040740)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 15805475 GRCz11 14 16111038 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGTGTGTGTGCGTGCGTGTGTGCATGTGTGTGTGCATGTGTGTGCCCA[G/T]ACTCCTCCAGATGAGAAGTCCACTCAGGCACTGAATGAGGCTCTGAACGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38989
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080120 | Essential Splice Site | 394 | 757 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20044730)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 15809465 GRCz11 14 16115028 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCTTGCCAACATCACACCTGAGATCCAGGCCAACTGGAAAGGACTATG[T/A]AAGATATCACACTCTTTACATGGATTCAAGTTCTCTACATTTTATATTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35678
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080120 | Nonsense | 561 | 757 | 14 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 20052194)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 15816929 GRCz11 14 16122492 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTTCACATATCAAATATTTGTTTTGTCTTCAAGGTCATGTGATTGCT[G/T]AGGAAGAGGCTCGTAAAGCTCACCAGCTGTGGCTTTCGGTTGAAGCTCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: