si:dkey-228d14.5

Ensembl ID:
ENSDARG00000057440
ZFIN ID:
ZDB-GENE-090313-252
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A6A2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35453 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080107 Nonsense 208 249 7 7
Genomic Location (Zv9):
Chromosome 13 (position 18382562)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18202597
GRCz11 13 18333589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCCAGGAGCATTACTTCTACAAGCAGATCTCAGCAGTGTTCGAGTG[G/A]TTTCTGTGTGTCAATCTGGAGCTCTACGAACTCAGCTACAGCGTAGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link