zgc:123339

Ensembl ID:
ENSDARG00000057437
ZFIN ID:
ZDB-GENE-051023-8
Description:
hypothetical protein LOC567972 [Source:RefSeq peptide;Acc:NP_001032784]
Human Orthologue:
APOD
Human Description:
apolipoprotein D [Source:HGNC Symbol;Acc:612]
Mouse Orthologue:
Apod
Mouse Description:
apolipoprotein D Gene [Source:MGI Symbol;Acc:MGI:88056]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080113 Nonsense 148 186 5 5
ENSDART00000125468 Nonsense 148 186 6 6
Genomic Location (Zv9):
Chromosome 24 (position 27103428)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26161785
GRCz11 24 26306826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGATGTTCTGCGGCTGTTTCATGTGGATTACGCCTGGATATTGTCA[C/T]GATCACGCTTTCTGCCTGCAGAGGCCGTCTATCATGCCAAAGAAATCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link