LOC100329651

Ensembl ID:
ENSDARG00000057436
Human Orthologues:
CT998553.1, MUC19
Human Descriptions:
mucin 19, oligomeric [Source:HGNC Symbol;Acc:14362]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MZH7]
Mouse Orthologue:
Muc19
Mouse Description:
mucin 19 Gene [Source:MGI Symbol;Acc:MGI:2676278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45868 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080097 Nonsense 385 915 10 23
Genomic Location (Zv9):
Chromosome Zv9_NA27 (position 30576)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149813.1 30576
GRCz11 KN149813.1 30576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCATTTAATAATTTAACGAGTGCTTTTTTTTAAATTTCAGGACAAATA[C/A]ACCTTCTCTGCAAACAGTATACAACTCAACAACATAGACATCGGTGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link