zgc:158677

Ensembl ID:
ENSDARG00000057427
ZFIN IDs:
ZDB-GENE-070209-134, ZDB-GENE-070209-134
Description:
synaptic vesicle protein 2B homolog [Source:RefSeq peptide;Acc:NP_001076464]
Human Orthologue:
SV2B
Human Description:
synaptic vesicle glycoprotein 2B [Source:HGNC Symbol;Acc:16874]
Mouse Orthologue:
Sv2b
Mouse Description:
synaptic vesicle glycoprotein 2 b Gene [Source:MGI Symbol;Acc:MGI:1927338]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34020 Nonsense Mutation detected in F1 DNA During 2018
sa20877 Nonsense Available for shipment Available now
sa977 Essential Splice Site Available for shipment Available now
sa16646 Nonsense Available for shipment Available now
sa25355 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080106 Nonsense 151 689 2 13
ENSDART00000124676 Nonsense 151 689 1 12
Genomic Location (Zv9):
Chromosome 7 (position 16043436)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15026315
GRCz11 7 15274602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCGCTCTGCCCAGTGCTGAGAAAGACATGTGCCTGTCCAATGCAGAC[A/T]AGGGCATGCTGGGTAAGTAAAATAGCCTGGAGATACATTCGGTGACTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080106 Nonsense 242 689 4 13
ENSDART00000124676 Nonsense 242 689 3 12
Genomic Location (Zv9):
Chromosome 7 (position 16057448)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15040327
GRCz11 7 15288614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTACGCTGAGTTTCTACAGATGGACAAGAGAGGAGAACATCTCAGCTG[G/A]CTGTGCTTGTTCTGGATGCTGGGAGGACTGTACGCTTCCTTCACTGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080106 Essential Splice Site 310 689 5 13
ENSDART00000124676 Essential Splice Site 310 689 4 12
Genomic Location (Zv9):
Chromosome 7 (position 16060160)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15043039
GRCz11 7 15291326
KASP Assay ID:
554-0882.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGCAGGGCTGGTGTTCATGCCAGAGAGTCCTCGTTTCCTTCTAGAGG[T/C]AAAATAGTTCTAWGATRGTTTACTAGTAACACACTCACACACNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080106 Nonsense 482 689 10 13
ENSDART00000124676 Nonsense 482 689 9 12
Genomic Location (Zv9):
Chromosome 7 (position 16067782)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15050661
GRCz11 7 15298948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATCGAAATAAGAAATGTGAAGTTCGAGGATTCGCTCTTTGAGAATTG[T/A]TATTTTGARGACATCAAATCAACAGAGACCTTCTTCGAGAACTGCACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080106 Nonsense 505 689 10 13
ENSDART00000124676 Nonsense 505 689 9 12
Genomic Location (Zv9):
Chromosome 7 (position 16067851)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15050730
GRCz11 7 15299017
KASP Assay ID:
554-7497.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACAGAGACCTTCTTCGAGAACTGCACCCTGAAAAACACAGTCTTCTA[C/A]AATACCGGTAATCAACTCAAACAAAACTAGATTAGTGTTTTTTTAATGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link