zgc:110708

Ensembl ID:
ENSDARG00000057426
ZFIN ID:
ZDB-GENE-050522-480
Description:
hypothetical protein LOC553793 [Source:RefSeq peptide;Acc:NP_001018591]
Human Orthologue:
C6orf130
Human Description:
chromosome 6 open reading frame 130 [Source:HGNC Symbol;Acc:21257]
Mouse Orthologue:
AI314976
Mouse Description:
expressed sequence AI314976 Gene [Source:MGI Symbol;Acc:MGI:2146818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37667 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080099 Essential Splice Site 8 155 2 6
Genomic Location (Zv9):
Chromosome 23 (position 19513659)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19298766
GRCz11 23 19225109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTCTTAAATCTCAGAGGAATCTAATGGACAAGTTCGTATCAAGGAAG[G/T]TAAGACAGATCATAAAAAGGCTACCTATTCAAGAGCATTTTAAAGAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link