slc44a5b

Ensembl ID:
ENSDARG00000057419
ZFIN ID:
ZDB-GENE-081105-4
Description:
Choline transporter-like protein 5-B [Source:UniProtKB/Swiss-Prot;Acc:B0S5A7]
Human Orthologue:
SLC44A5
Human Description:
solute carrier family 44, member 5 [Source:HGNC Symbol;Acc:28524]
Mouse Orthologue:
Slc44a5
Mouse Description:
solute carrier family 44, member 5 Gene [Source:MGI Symbol;Acc:MGI:3035141]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21246 Nonsense Available for shipment Available now
sa12513 Nonsense Available for shipment Available now
sa15953 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080079 Nonsense 127 729 6 22
ENSDART00000134660 Nonsense 99 701 4 20
Genomic Location (Zv9):
Chromosome 8 (position 18410135)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17855023
GRCz11 8 17890735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGTGTGTATCCAAGTGCCCAGACAGATTTGCCACATACATTGACATG[C/T]AATACAGCTACAGACGCAATAAGGGCTCCTGGGAATACTACAAGCAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080079 Nonsense 507 729 16 22
ENSDART00000134660 Nonsense 479 701 14 20
Genomic Location (Zv9):
Chromosome 8 (position 18427164)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17872052
GRCz11 8 17907764
KASP Assay ID:
2260-0376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTKATATRGTAAATTTAAAAAYAACAAATTTTGTAATRTTRTTCCAGGTA[T/G]CACACAGGCTCTCTRGCATTTGGAGCTTTGATTCTGTCCATTGTCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080079 Nonsense 591 729 18 22
ENSDART00000134660 Nonsense 563 701 16 20
Genomic Location (Zv9):
Chromosome 8 (position 18428095)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17872983
GRCz11 8 17908695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATATGGGAAGAATTTCTGTACTTCAGCGAGAGATGCTTTCTTCCTGT[T/A]AAYGAGGAATGTCATGAGGTAAGAGTCACAGYTGAGGTGTTTCTAATGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link