zgc:153710

Ensembl ID:
ENSDARG00000057394
ZFIN ID:
ZDB-GENE-060825-283
Description:
ras-related protein Rab-33A [Source:RefSeq peptide;Acc:NP_001038893]
Human Orthologue:
RAB33A
Human Description:
RAB33A, member RAS oncogene family [Source:HGNC Symbol;Acc:9773]
Mouse Orthologue:
Rab33a
Mouse Description:
RAB33A, member of RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:109493]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35661 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080042 Essential Splice Site 88 236 1 2
Genomic Location (Zv9):
Chromosome 14 (position 15431482)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17293468
GRCz11 14 17599121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGGATTTCAGGGAGAAAGCGGTGGAGATCGAGGGCGAGAAAATAAAG[G/A]TGGGATTTATAGAAGGGGTTGCTCTCGCCCTGAAGGCCGACATCTCGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link