zgc:73311

Ensembl ID:
ENSDARG00000057378
ZFIN ID:
ZDB-GENE-030131-2459
Description:
selenoprotein U [Source:RefSeq peptide;Acc:NP_001180454]
Human Orthologue:
C10orf58
Human Description:
chromosome 10 open reading frame 58 [Source:HGNC Symbol;Acc:28651]
Mouse Orthologue:
5730469M10Rik
Mouse Description:
RIKEN cDNA 5730469M10 gene Gene [Source:MGI Symbol;Acc:MGI:1917814]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13116 Nonsense Available for shipment Available now
sa42175 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080025 Nonsense 29 229 1 7
ENSDART00000122300 Nonsense 29 229 1 7
ENSDART00000133062 Nonsense 40 101 2 3
ENSDART00000134740 Nonsense 18 104 3 5
ENSDART00000141647 Nonsense 18 102 1 3
ENSDART00000147905 Nonsense 18 212 2 6
Genomic Location (Zv9):
Chromosome 13 (position 18712672)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18532707
GRCz11 13 18663699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCATGTGGYCACTTGGCCTTGGGGCAGTAGGTGCCGCTATTGCTGGCT[T/G]AATACTTGCAAACACTGACTTCCTGCTGACTAAATCTGCACCTGCTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080025 Nonsense 82 229 2 7
ENSDART00000122300 Nonsense 82 229 2 7
ENSDART00000133062 Nonsense 93 101 3 3
ENSDART00000134740 Nonsense 71 104 4 5
ENSDART00000141647 Nonsense 71 102 2 3
ENSDART00000147905 Nonsense 71 212 3 6
Genomic Location (Zv9):
Chromosome 13 (position 18712948)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18532983
GRCz11 13 18663975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAAAAGCTCTTTGGGAGAAGTCAGGTGCAGTGATTATGGCTGTCCGG[C/T]GACCTGGATGATTTTTGTGCAGAGAGGTAAGTGGTCATAATACTCTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link