zgc:63990

Ensembl ID:
ENSDARG00000057322
ZFIN IDs:
ZDB-GENE-040426-2644, ZDB-GENE-040426-2644
Description:
Transmembrane protein 47 [Source:UniProtKB/Swiss-Prot;Acc:Q6PFT6]
Human Orthologue:
TMEM47
Human Description:
transmembrane protein 47 [Source:HGNC Symbol;Acc:18515]
Mouse Orthologue:
Tmem47
Mouse Description:
transmembrane protein 47 Gene [Source:MGI Symbol;Acc:MGI:2177570]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17528 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063518 Essential Splice Site 123 181 None 4
ENSDART00000123917 Essential Splice Site 123 181 None 3
Genomic Location (Zv9):
Chromosome 8 (position 19089918)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18534806
GRCz11 8 18570518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCTTTGATGATWACAAATTTCATTGCCAGCGCTCTTCTGTTTCTCAC[A/T]GTGGTCCTGCAGGCCTGCTGTTTGGTGCTGTATCCCATCAAGTTCATCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link